Partner ID 1097
Name Lecithin retinol acyltransferase
Synonyms 2888
Gene name LRAT
General function Involved in acyltransferase activity
Specific function Transfers the acyl group from the sn-1 position of phosphatidylcholine to all-trans retinol, producing all-trans retinyl esters. Retinyl esters are storage forms of vitamin A. LRAT plays a critical role in vision. It provides the all-trans retinyl ester substrates for the isomerohydrolase which processes the esters into 11-cis-retinol in the retinal pigment epithelium; due to a membrane-associated alcohol dehydrogenase, 11 cis-retinol is oxidized and converted into 11-cis-retinaldehyde which is the chromophore for rhodopsin and the cone photopigments
Gene sequence + ...

ATGAAGAACCCCATGCTGGAGGTGGTGTCTTTACTACTGGAGAAGCTGCTCCTCATCTCCAACTTCACGCTCTTTAGTTCGGGCGCCGCGGGCAAGGACAAAGGGAGGAACAGTTTTTATGAAACCAGCTCTTTCCACCGAGGCGACGTGCTGGAGGTGCCCCGGACCCACCTGACCCACTATGGCATCTACCTAGGAGACAACCGTGTTGCCCACATGATGCCCGACATCCTGTTGGCCCTGACAGACGACATGGGGCGCACGCAGAAGGTGGTCTCCAACAAGCGTCTCATCCTGGGCGTTATTGTCAAAGTGGCCAGCATCCGCGTGGACACAGTGGAGGACTTCGCCTACGGAGCTAACATCCTGGTCAATCACCTGGACGAGTCCCTCCAGAAAAAGGCACTGCTCAACGAGGAGGTGGCGCGGAGGGCTGAAAAGCTGCTGGGCTTTACCCCCTACAGCCTGCTGTGGAACAACTGCGAGCACTTCGTGACCTACTGCAGATATGGCACCCCGATCAGTCCCCAGTCCGACAAGTTTTGTGAGACTGTGAAGATAATTATTCGTGATCAGAGAAGTGTTCTTGCTTCAGCAGTCTTGGGATTGGCGTCTATAGTCTGTACGGGCTTGGTATCATACACTACCCTTCCTGCAATTTTTATTCCATTCTTCCTATGGATGGCTGGCTAA

Protein sequence + ...

MKNPMLEVVSLLLEKLLLISNFTLFSSGAAGEDKGRNSFYETSSFHRGDVLEVPRTHLTHYGIYLGDNRVAHMMPDILLALTDDMGRTQKVVSNKRLILGVIVKVASIRVDTVEDFAYGANILVNHLDESLQKKALLNEEVARRAEKLLGFTPYSLLWNNCEHFVTYCRYGTPISPQSDKFCETVKIIIRDQRSVLASAVLGLASIVCTGLVSYTTLPAIFIPFFLWMAG

GO Classification Not Available
See more information at   →   www.drugbank.ca
Id Name
DB00162 Vitamin A
Id Name
DB00157 NADH
DB00162 Vitamin A
DB00165 Pyridoxine
DB00169 Cholecalciferol
DB00170 Menadione
DB00176 Fluvoxamine
DB00184 Nicotine
DB00188 Bortezomib
DB00197 Troglitazone
DB00201 Caffeine
DB00203 Sildenafil
DB00208 Ticlopidine
DB00277 Theophylline
DB00316 Acetaminophen
DB00317 Gefitinib
DB00325 Nitroprusside
DB00338 Omeprazole
DB00356 Chlorzoxazone
DB00363 Clozapine
DB00381 Amlodipine
DB00396 Progesterone
DB00428 Streptozocin
DB00448 Lansoprazole
DB00457 Prazosin
DB00459 Acitretin
DB00466 Picrotoxin
DB00468 Quinine
DB00470 Dronabinol
DB00499 Flutamide
DB00502 Haloperidol
DB00518 Albendazole
DB00526 Oxaliplatin
DB00530 Erlotinib
DB00539 Toremifene
DB00553 Methoxsalen
DB00568 Cinnarizine
DB00571 Propranolol
DB00575 Clonidine
DB00586 Diclofenac
DB00605 Sulindac
DB00608 Chloroquine
DB00613 Amodiaquine
DB00624 Testosterone
DB00633 Dexmedetomidine
DB00636 Clofibrate
DB00643 Mebendazole
DB00655 Estrone
DB00675 Tamoxifen
DB00682 Warfarin
DB00693 Fluorescein
DB00694 Daunorubicin
DB00730 Thiabendazole
DB00738 Pentamidine
DB00740 Riluzole
DB00755 Tretinoin
DB00783 Estradiol
DB00804 Dicyclomine
DB00818 Propofol
DB00851 Dacarbazine
DB00882 Clomifene
DB00889 Granisetron
DB00898 Ethanol
DB00908 Quinidine
DB00926 Etretinate
DB00972 Azelastine
DB01013 Clobetasol
DB01026 Ketoconazole
DB01041 Thalidomide
DB01059 Norfloxacin
DB01064 Isoproterenol
DB01065 Melatonin
DB01087 Primaquine
DB01092 Ouabain
DB01095 Fluvastatin
DB01115 Nifedipine
DB01118 Amiodarone
DB01129 Rabeprazole
DB01136 Carvedilol
DB01167 Itraconazole
DB01169 Arsenic trioxide
DB01174 Phenobarbital
DB01234 Dexamethasone
DB01254 Dasatinib
DB01388 Mibefradil
DB01393 Bezafibrate
DB01407 Clenbuterol
DB01770 All-Trans Axerophthene
DB01907 Nicotinamide-Adenine-Dinucleotide
DB02709 Resveratrol
DB03783 Phenacetin
DB03917 N-Ethyl Retinamide
DB04447 1,4-Dithiothreitol
DB04840 Debrisoquin
DB04841 Flunarizine
DB04871 Lorcaserin
DB05076 Fenretinide
DB06770 Benzyl alcohol
DB06985 2-[({4-[2-(trifluoromethyl)phenyl]piperidin-1-yl}carbonyl)amino]benzoic acid
DB08846 Ellagic Acid