| Name |
30S ribosomal protein S8 |
| Synonyms |
8952 |
| Gene name |
rpsH |
| General function |
Translation, ribosomal structure and biogenesis |
| Specific function |
One of the primary rRNA binding proteins, it binds directly to 16S rRNA where it helps nucleate assembly of the platform of the 30S subunit central domain. The combined cluster of proteins S8, S12 and S17 appears to hold together the shoulder and platform of the 30S subunit |
| Gene sequence |
+ ...
ATGCCTAAGAAGGTGCTGACCGGGGTGGTGGTGAGCGACAAGATGCAGAAGACCGTGACGGTCTTGGTGGAGCGCCAGTTCCCCCACCCCCTTTACGGCAAGGTCATCAAGCGCTCCAAAAAGTACCTGGCCCATGACCCCGAGGAGCGGTACAAGGTGGGGGACGTGGTGGAGATCATAGAGGCCCGCCCCATCTCCAAGCGCAAGCGATTCCGGGTCCTGCGCTTGGTGGAAGAGGGGCGGCTGGACCTGGTGGAGAAGTACCTGGTACGCCGCCAGAACTACGCTAGCCTTTCCAAGCGGGGAGGTAAGGCATGA
|
| Protein sequence |
+ ...
MLTDPIADMLTRIRNATRVYKESTDVPASRFKEEILRILAREGFIKGYERVDVDGKPYLRVYLKYGPRRQGPDPRPEQVIHHIRRISKPGRRVYVGVKEIPRVRRGLGIAILSTSKGVLTDREARKLGVGGELICEVW
|
| GO Classification |
| component |
| ribonucleoprotein complex |
| ribosome |
| cell |
| intracellular |
| protein complex |
| function |
| structural molecule activity |
| structural constituent of ribosome |
| process |
| protein biosynthesis |
| physiological process |
| metabolism |
| macromolecule metabolism |
| macromolecule biosynthesis |
|
|
See more information at →
www.drugbank.ca
|