Partner ID 6840
Name Virulence sensor histidine kinase phoQ
Synonyms 9087
Gene name phoQ
General function Signal transduction mechanisms
Specific function Member of the two-component regulatory system phoQ/phoP which regulates the expression of genes involved in virulence, adaptation to low Mg(2+) environments and resistance to host defense antimicrobial peptides. In presence of low periplasmic Mg(2+) concentrations, phoQ functions as a membrane-associated protein kinase that undergoes autophosphorylation and subsequently transfers the phosphate to phoP, which results in the expression of phoP-activated genes (PAG) and repression of phoP-repressed genes (PRG). In presence of high periplasmic Mg(2+) concentrations, acts as a protein phosphatase that dephosphorylates phospho-phoP, which results in the repression of phoP-activated genes and may lead to expression of some phoP- repressed genes. Promotes intramacrophage survival of S.typhimurium. Is essential for transcription of spiC inside macrophages by controlling the expression of the two-component regulatory system ssrB/spiR at transcriptional and post- transcriptional levels respectively. Promotes expression of the two-component regulatory system pmrA/pmrB via activation of pmrD gene. Is required to attenuate bacterial growth within fibroblast cells and to enhance bacterial resistance to bile in intestinal cells. Also, negatively regulates prgH, which is required for invasion of epithelial cells
Gene sequence + ...

ATGATGCGCGTACTGGTTGTAGAGGATAATGCATTATTACGCCACCACCTGAAGGTTCAGCTCCAGGATTCAGGTCACCAGGTCGATGCCGCAGAAGATGCCAGGGAAGCTGATTACTACCTTAATGAACACCTTCCGGATATCGCTATTGTCGATTTAGGTCTGCCGGATGAAGACGGCCTTTCCTTAATACGCCGCTGGCGCAGCAGTGATGTTTCACTGCCGGTTCTGGTGTTAACCGCGCGCGAAGGCTGGCAGGATAAAGTCGAGGTTCTCAGCTCCGGGGCCGATGACTACGTGACGAAGCCATTCCACATCGAAGAGGTAATGGCGCGTATGCAGGCGTTAATGCGCCGTAATAGCGGTCTGGCCTCCCAGGTGATCAACATCCCGCCGTTCCAGGTGGATCTCTCACGCCGGGAATTATCCGTCAATGAAGAGGTCATCAAACTCACGGCGTTCGAATACACCATTATGGAAACGCTTATCCGTAACAACGGTAAAGTGGTCAGCAAAGATTCGCTGATGCTTCAGCTGTATCCGGATGCGGAACTGCGGGAAAGTCATACCATTGATGTTCTCATGGGGCGTCTGCGGAAAAAAATACAGGCCCAGTATCCGCACGATGTCATTACCACCGTACGCGGACAAGGATATCTTTTTGAATTGCGCTAA

Protein sequence + ...

MNKFARHFLPLSLRVRFLLATAGVVLVLSLAYGIVALVGYSVSFDKTTFRLLRGESNLFYTLAKWENNKISVELPENLDMQSPTMTLIYDETGKLLWTQRNIPWLIKSIQPEWLKTNGFHEIETNVDATSTLLSEDHSAQEKLKEVREDDDDAEMTHSVAVNIYPATARMPQLTIVVVDTIPIELKRSYMVWSWFVYVLAANLLLVIPLLWIAAWWSLRPIEALAREVRELEDHHREMLNPETTRELTSLVRNLNQLLKSERERYNKYRTTLTDLTHSLKTPLAVLQSTLRSLRNEKMSVSKAEPVMLEQISRISQQIGYYLHRASMRGSGVLLSRELHPVAPLLDNLISALNKVYQRKGVNISMDISPEISFVGEQNDFVEVMGNVLDNACKYCLEFVEISARQTDDHLHIFVEDDGPGIPHSKRSLVFDRGQRADTLRPGQGVGLAVAREITEQYAGQIIASDSLLGGARMEVVFGRQHPTQKEE

GO Classification
component
cell
membrane
function
protein kinase activity
purine nucleotide binding
adenyl nucleotide binding
protein histidine kinase activity
transferase activity
two-component sensor molecule activity
binding
nucleotide binding
signal transducer activity
catalytic activity
ATP binding
transferase activity, transferring phosphorus-containing groups
kinase activity
process
protein modification
protein amino acid phosphorylation
phosphorus metabolism
physiological process
phosphate metabolism
phosphorylation
cellular process
metabolism
cell communication
cellular metabolism
signal transduction
macromolecule metabolism
biopolymer metabolism
biopolymer modification
See more information at   →   www.drugbank.ca
Id Name
DB03758 Radicicol